Lactose intolerance affects around 70% of adults worldwide. Generally, a healthy newborn baby can digest about 60–70 g of lactose per day (roughly one litre of breast milk) due to the presence of the enzyme lactase in the small intestine. However, after weaning, lactase expression typically declines, leading to lactose intolerance in adulthood. This is known as lactase non-persistence (LNP) and is the ancestral state for humans.
The lactase gene (LCT) is located on chromosome 2 and is regulated by the MCM6 locus (minichromosome maintenance complex component 6), which lies about 14 kbp upstream. Several single nucleotide polymorphisms (SNPs) within the MCM6 locus influence the expression of LCT. Certain variants create additional binding sites for transcriptional repressors, reducing the transcription of MCM6 and ultimately lowering lactase production, leading to lactose intolerance. Conversely, other SNPs within this region disrupt these repressor sites, allowing lactase expression to persist into adulthood. This is known as lactase persistence (LP).
With the advent of animal domestication and dairying practices, milk became a reliable and nutrient-rich food source for many populations. This shift created strong selective pressure for genetic variants that allowed adults to continue producing lactase and digesting lactose — lactase persistence. Because this selection occurred independently in different regions, distinct genetic variants conferring lactase persistence arose in separate populations. The distribution of the five most common variants are shown in the figure below. Note that all of these variants are located within intron 13 of the MCM6 gene.

SNPs associated with lactase persistence in different populations: from The molecular basis of lactase persistence: Linking genetics and epigenetics
We will be focusing on the Eurasian lactase persistence SNP, rs4988235, sometimes referred to as 13910C>T as in the figure above. The A allele enhances activator binding which increases lactase gene expression into adulthood.

SNPs conferring lactase persistence: This figure shows a schematic of the MCM6 intron 13 lactase persistence enhancer region. The light grey represents the genomic sequence in the human reference genome GRCh38 (chr2:135,850,966-135,851,196). The coloured boxes represent transcription factor binding sites and the red lines identify the five SNPs in this region conferring lactase persistence. Image from The molecular basis of lactase persistence: Linking genetics and epigenetics
In this practical (and the next three) we will use a read alignment and variant calling workflow to determine the genotype of three samples at the site of the rs4988235 SNP. We will then consider how this relates to the phenotype of lactose tolerance.
The main steps in this workflow are shown in the figure below along with the file types produced by each step.
The data we will analyse with this workflow includes Illumina paired-end reads from three Iberian individuals sequenced as part of the 1000 Genomes project and a 7Mbp (7 million basepairs) segment of the human reference genome GRCh38.p14.
The first step in a bioinformatics analysis/workflow is always quality control (QC) and that will be the focus for today and the next practical. This includes checking the quality of raw data, trimming our raw data, and then re-checking quality. We have included an extra sample for the initial quality assessment so that you see reads of varying quality.
This practical will again be using RStudio to interact with our VM’s. See the first practical to remind yourself how to connect.
All of the code/commands in this practical should be run in the terminal pane.
Please use the same filenames and paths as the practical.
The practicals use an anaconda (conda) software environment to provide access to the software you’ll need. This is very common practice in bioinformatics. We have set up these environments already so you just need to activate them.
For today’s practical, you will need to activate the bioinf conda environment:
cd ~
source activate bioinf
If this command works properly, it should produce no output. If this command fails and gives you an error message do the following:
echo -e "envs_dirs:\n- /apps/conda3/singularity/envs" > ~/.condarc
source activate bioinf
Everyones prompt should now have changed to look something like below:
(bioinf) a1234567@ip-10-255-0-115:/shared/a1234567$
The (bioinf) prefix lets you know you are in the bioinf conda environment, with access to the packages/tools installed in that environment.
It gives us access to both of the tools (fastqc and fastp) that we need for todays practical.
Let’s create a new directory for todays practical and create subdirectories that reflect the main steps in our analysis. This will help us stay organised.
The command tree shows the the structure of the Practical_alignment directory.
mkdir --parents ~/Practical_alignment/{ref,0_raw,1_trim,2_align,3_variants}
# Take a look at the directory structure we created.
tree Practical_alignment
It should look something like below.
Practical_alignment/
├── 0_raw
├── 1_trim
├── 2_align
├── 3_variants
└── ref
Questions
mkdir command, what did the argument --parents do?ref, 0_raw, 1_trim etc. inside the curly braces?The data associated with bioinformatics can take up a lot of storage space. Because data storage is usually limited and is surprisingly expensive, we need to manage our data carefully. One way we can do that is by using symlinks.
A symlink (or ‘symbolic link’) is a shortcut that points to another file or folder. It lets you access the original file from a different location without duplicating it and thereby saves disk space. This is a good technique if multiple people need to access the same dataset on a shared system (eg. Phoenix).
For example, the compressed fastq files we’ll be using today are ~21 Mb each and there are 6 of them, totalling ~120Mb. If 60 students all copy these files to their project directories, that’s over 7Gb of extra data being stored. Therefore, we will use symlinks to access the raw fastq files for our analysis. We could also do this with the reference sequence but we won’t today so that we can compare how these files appear in our directory.
cd Practical_alignment
## copy reference genome
cp ~/data/intro_ngs/chr2_sub.fa ref/
## make symlinks for all .fq.gz files at once
ln -s ~/data/intro_ngs/*.fq.gz 0_raw/
tree .
The directory structure should now be as below.

Notice how the reference sequence is listed just by its name in black while the local symlink names are blue with an arrow pointing to the full path to the linked file in red.
In the 0_raw directory you should have 8 files. There are two files for each sample, containing Read 1 and Read 2 respectively for a total of 4 samples. The samples starting with ERR are the Iberian samples we will be analysing with our variant calling workflow and the unknown sample is provided so that you get to see data of a different quality.
To list just the files in the 0_raw directory we can use ls. Compare the output of the two ls commands below and answer the questions. Don’t forget about the man command if you need help.
ls 0_raw
ls -lh 0_raw
Questions:
-l and -h?In order to analyse our data, we need to understand how it was generated. We are analysing paired-end reads from Illumina, the most commonly used short-read sequencing platform. Illumina uses the Sequencing by Synthesis method which you will have learned about in the course materials. More information on Illumina sequencing is available on their website.
The figure below shows the different parts of an Illumina sequencing template.

Question:
The adapters contain the sequencing primer binding sites (R1 and R2 Primers), index sequences, and the sites that allow library fragments to attach to the flow cell lawn (P5 and P7). There are a limited number of standard Illumina adapter sequences (detailed here) and so tools are often able to determine which adapter was used automatically.
This is the fragment of DNA that we want to sequence. If we are using barcodes, the barcode is ligated directly to the DNA fragment and is included in the read (barcodes are not shown here).
Indexes and barcodes are similar in that they allow multiple samples to be pooled together in a single sequencing run and later separated by their unique sequence tags. This is called multiplexing and separating reads by their index or barcode into individual samples is called de-multiplexing. Indexes are not included in either the forward or reverse read (indexes are shown in the figure above) and are commonly used in RNA-seq libraries. Indexed samples are generally de-multiplexed by the sequence provider. If barcodes are used to further multiplex samples, they will be ligated directly to the DNA insert and will be included in the read itself. De-multiplexing barcoded samples is not performed by the sequencing provider. Instead, a bioinformatician will de-multiplex using a tool like sabre.
In general, Illumina sequencing produces highly accurate reads but read quality does tend to diminish towards the 3’ end. During the bridge-amplification stage, millions of clusters are created on the flowcell. Each cluster comprises of 1,000-2,000 identical copies of the same template. During the process of sequencing, the polymerases attached to each of the thousands of copies in a cluster “advance” one base at a time. At the start (5’ end) all the polymerases are in perfect sync; generating a bright, clean, consistant light signal for detecting which base was incorporated. However, as time/number of cycles progresses, some polymerases fall behind while some race in front. The polymerases gradually get further and further out of phase with each other. This leads to dimmer and less clear signals for detection, and thus lower quality base-calls.
Illumina uses only two fluorescent colours in its chemistry to represent the four bases.
One limitation of this system is that if the signal from a cluster becomes too weak to detect, the instrument interprets the lack of signal as a string of high confidence G’s, even if the real bases are different. This tends to happen more often near the 3’ end of reads.
Illumina reads are stored in FASTQ files with the extension .fq or .fastq.
These files are plain-text but are often very large so are commonly compressed using gzip.
The .gz extension is added to signify this.
Most modern bioinformatics tools can read gzip compressed files and so you should keep them compressed unless you are using a tool that specifically requires them to be decompresed.
Let’s take a look at the first 8 lines in 0_raw/ERR3241917_1.fq.gz.
zcat 0_raw/ERR3241917_1.fq.gz | head -n 8
You should see something like this:
@ERR3241917.10210 A00296:38:HFH2MDSXX:3:2337:7139:6402/1
GCAAATCAAAACCACTATGAGATATCTCACACCAGTTAGAATGGCAATCATTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAATAGGAACACTTTTACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAA
+
?????????????????????????????????????????????????????????????????????????????????????????????+????????????????????????????????????????????????????????
@ERR3241917.14387 A00296:38:HFH2MDSXX:4:1413:17933:15483/1
GTGACAGTGTGAGACTCTGTCCAAAAAAAAAAAAAAAAAAAAAAAATAAAGAAAAGAAAAAAAAAAAAATAAAAAAAGGTAAATAAAAAAAAGGAAAAATAAATAAATAAAAAAAAAAATAAAAAAATAAAAAAAAAAAAACAACCCAAA
+
??????????????????????????????????????????????+???+????+??????????+??++?????++++'??+???????+???????+??++???+???+??+????+???+????'?++???+???++??++?++??
This shows us two reads and each read is made up of 4 lines. The four lines are:
@ symbol+ symbol. The read identifier may also immediately follow but this is uncommon.The first and fourth line are explained more in the next few sections.
The read identifier line always begins with an @ symbol but may vary significantly after this depending on where the data came from (directly from the sequencing provider vs downloaded from public database). The figure below explains the components of the first read identifier that we saw above. If you received this data directly from Illumina, it would not contain the first two fields as this was added when the data was made publicly available. Instead it would start with the @ followed directly by the machine ID. The remaining parts of the header are fairly standard for illumina sequencing.

This information can be helpful in identifying if any spatial effects have affected the quality of the reads. You usually won’t need most of this information, but it can be handy for times of serious data exploration.
Take a look at the beginning of the ERR3241917_2.fq.gz file.
zcat 0_raw/ERR3241917_2.fq.gz | head -n 8
You will notice that the information in the identifier is identical to the first file we inspected, with the exception that there is a 2 at the end. This indicates that these reads are the second in the pair of reads. The two files will have an identical structure where the order of the sequences in one is identical to the order of the sequences in the other. This way when they are read as a pair of files, they can be stepped through read-by-read.
Now have a look at one of the unknown sample fastq files to see what information the read IDs contain.
zcat 0_raw/unknown_R1.fq.gz | head -n 16
Each read ID should contain:
As you can see, the information in the identifier can vary quite a lot depending on where the data came from.
The quality string has a character for each base in the sequence string that indicates how confidently that base was called. Therefore, the length of the sequence string and the quality string should match. Quality values are numbers from 0 to 93 and are often referred to as “Phred” quality scores. To encode the quality scores as a single character (so that the sequence string and quality string are the same length), the scores are mapped to the ASCII table:
Standard ASCII Chart - Hex to Decimal code conversion

Chart above from https://www.commfront.com/pages/ascii-chart
You will see that the first 33 characters in the table (decimal values of 0-32) are all non-printable or white-space (think space, tab, backspace, bell etc). The first printable character is ! and this has the decimal value of 33. This character is used to represent a quality value of 0 while " has a decimal value of 34 and represents a quality value of 1 (34-33).
As such these quality scores are said to be Phred+33 encoded and the quality score is simply obtained by substracting 33 from the decimal value of the character in the quality string.
Quality score values usually range from 0 (!) to 40 (I) but some go a bit higher.
If you go digging into old Illumina files, you may find quality values which are Phred+64 encoded. That is, a quality value of 0 is represented by @ which has a decimal value of 64. However, Phred+33 encoding is the current standard and is often referred to as Illumina 1.9.
Phred quality scores give a measure of the confidence the caller has that the sequence base is correct. To do this, the quality scores are related to the probability of calling an incorrect base through the formula
Q = −10log₁₀P
where P is the probability of calling the incorrect base. This is more easily seen in the following table:
| Phred Score | Phred+33 Encoded Character | Probability of Incorrect Base Call | Accuracy of Base Call |
|---|---|---|---|
| 0 | ! |
1 | 0% |
| 10 | + |
10-1 | 90% |
| 20 | 5 |
10-2 | 99% |
| 30 | ? |
10-3 | 99.9% |
| 40 | I |
10-4 | 99.99% |
unknown_R1.fq.gz, the quality string included the characters A, !, and J (as well as some others). Use the ASCII table to determine what Phred score (a number between 0 and 41) these characters represent.You might have noticed that the quality scores in your Iberian sample FASTQ files don’t contain a very wide range of characters. This is because quality scores are often binned to reduce filesize.
“Binning” groups similar quality values together so that instead of storing dozens of possible Phred scores, the file only stores a smaller set of representative values. This makes FASTQ files smaller and easier to archive, with little impact on most downstream analyses. As long as the relative differences in quality are preserved, aligners and many variant callers can still perform well. However, it does mean that the quality plots you see in tools like FastQC may appear more “stepped” or uniform than expected, and very fine-grained distinctions in base accuracy are not captured
Now that we know what our data looks like (FASTQ files), we can start Quality Control (QC).
QC generally consists of 3 steps:
We will be using FastQC to check the quality of our raw and trimmed data and fastp to do the trimming.
Both of these tools are very commonly used for quality control with Illumina reads.
Let’s look at the help file for FastQC to see how it works.
fastqc -h | less
-o option do?-t option do?-o and --outdir options?fastqc is expecting our command structure to look like. Compare it with the fastqc command we are going to run below to see how it works.Type q to exit when you’re finished.
Let’s run FastQC on our unknown sample.
# create a directory for FastQC output files
mkdir -p ~/Practical_alignment/0_raw/FastQC
# Make sure you're in the right directory
cd ~/Practical_alignment
# Run fastqc
fastqc -o 0_raw/FastQC/ -t 2 0_raw/unknown_R*.fq.gz
The above command:
* in the place of the value 1 or 2.-o ~/Practical_alignment/0_raw/FastQC) and-t 2).FastQC creates an .html report (and a zip file but we don’t need that) for each file provided which can be opened in a web browser.
To view the reports, use the Files pane to navigate to ~/Practical_alignment/0_raw/FastQC and open both of the html files you find (If you don’t see any html files call a tutor). Click on a file and then choose View in Web Browser and the file will open in your browser.
Let’s look at the FastQC reports for our Unknown sample. These reads are paired-end RNA-seq.
Using the Basic Statistics information at the top of the FastQC reports, answer the following questions:
The left hand menu contains a series of clickable links to navigate through the report, with a quick guideline about each section given as a tick, cross or exclamation mark.
Let’s look at some other parts of the report.
Click on the Per base sequence quality hyper-link on the left of the page & you will see a boxplot of the QC score distributions for every position in the read.
These are produced from the Phred scores we discussed earlier, and this plot is usually the first one that bioinformaticians will look at for making informed decisions about the overall quality of the data and settings for later stages of the analysis.
The red dashed line indicates the maximum quality score at that position in the read and the blue line indicates the average quality score at that position.
In a WGS experiment where DNA is randomly fragmented, we would expect to see relatively flat horizontal lines across this plot. Depending on the GC content of the species, we might see the A and T lines tracking together but separately from the G and C lines. RNA-Seq data will usually fail this section because the “random” hexamer priming used in RNA-seq library preparation is not truly random. Additionally, this plot may also show artefacts from barcode sequences or adapters early in the reads before stabilising. It is also relatively common to see a drift towards G towards the end of a read. This is because most modern Illumina sequencing is performed on a “2-colour” system and G is the absence of both colours.
This plot gives the GC distribution of all sequences. The line should be normal(ish) for whole genome sequencing but sharp peaks are not unusual in RNA-Seq indicating highly-expressed sequences. The peak of the curve should align with the expected GC content of the species.
The distributions of sequence lengths in our data. Here we have sequences that are all the same lengths, however if the length of your reads is vital (e.g. smallRNA data), then this can plot can be informative.
This plot shows about what you’d expect from a typical NGS experiment. There are few to no duplicated sequences and lots of unique sequences representing the diverse transcriptome. This is only calculated on a small sample of the library for computational efficiency and is just to give a rough guide if anything unusual stands out.
Here we can see any sequence which are more abundant than would be expected. A normal high-throughput library will contain a diverse set of sequences but sometimes we find that some sequences are more common than we would expect. This can be for a range of reasons. It could mean that a sequence is highly biologically significant (ie. in RNA-seq), indicate that the library is contaminated, or it could be the result of a sequencing artifact. Sometimes you will also see sequences here that match the adapters used in the library prep.
For whole genome shotgun sequencing library preps we expect to see little adapter content in the reads. If there is a significant up-turn in adapter content towards the 3’ end, this may indicate the genomic DNA was over-fragmented during library prep.
Questions: Remembering that the Unknown sample is RNA-seq, answer the following:
This is a FastQC report of poor quality reads. Look through the report and read the notes below.
Per Base Sequence Quality - Looking at the first plot, we can clearly see this data is not as high quality as the one we have been exploring ourselves.
Per Tile Sequence Quality - Some physical artefacts are visible and some tiles seem to be consistently lower quality. Whichever approach we take to cleaning the data will more than likely account for any of these artefacts. Sometimes it’s just helpful to know where a problem has arisen.
Overrepresented Sequences - There seem to be a lot of enriched sequences of unknown origin. There is one hit to an Illumina adapter sequence, so we know at least one of the contaminants in the data. Note that some of these sequences are the same as others on the list, just shifted one or two base pairs. A possible source of this may have been non-random fragmentation.
Interpreting these reports can take time and experience. Descriptions of each of the sections are provided here by the FastQC authors.
Run fastqc on the sample ERR3241917 and look through the FastQC reports to answer the following questions.
fastqc -o 0_raw/FastQC -t 2 0_raw/ERR3241917_*.fq.gz
Now run fastqc on your two other human samples and check their reports.
In the next practical, we’ll finish quality control by trimming our data and then re-assessing data quality.