BIOTECH-7005-BIOINF-3000

Week 12 Transcriptomics Practical - assembly

By Zhipeng Qu

Introduction

In this practical, we will use a RNA-Seq dataset from a model plant Arabidopsis thaliana (Wang et al, 2017, https://onlinelibrary.wiley.com/doi/10.1111/tpj.13481). This dataset was initially used for identification of long non-coding RNAs by transcriptome assembly of RNA-Seq.

Dataset

Due to the the limitation of computing resources in our VM, we will use a subset of raw reads (reads from chromomose 2 of Arabidopsis) from one of three biological replicates sampled from leaf tissue. Here are some informations for Arabidopsis and this RNA-Seq datatset:

Tools and pipeline

The pipeline of today’s Prac is shown in the following flowchart:

Transcriptome assembly flowchart

Tools used in this Prac:

Tool/Package Version URL
fastQC v0.11.9 https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
cutadapt 3.5 https://cutadapt.readthedocs.io/en/stable/
Trinity 2.15.1 https://github.com/trinityrnaseq/trinityrnaseq/wiki
GMAP 2021-12-17 http://research-pub.gene.com/gmap/
STAR 2.7.10a https://github.com/alexdobin/STAR
StringTie v2.2.1 https://ccb.jhu.edu/software/stringtie/
BUSCO 5.4.4 https://busco.ezlab.org/
gffread 0.12.7 http://cole-trapnell-lab.github.io/cufflinks/
IGV web https://software.broadinstitute.org/software/igv/

Running time estimate (based on teaching VM)

The following table shows the estimated run time in VM for the major steps:

Step Tool/Package Estimated run time
QC fastQC 3 mins
Sequence trimming cutadapt 4 mins
De novo assembly Trinity 2.5 hrs
Genome mapping for transcripts GMAP 3 mins
Genome mapping for short reads STAR 10 mins
Genome-guided assembly StringTie 1 mins
BUSCO for Trinity BUSCO 3 mins
BUSCO for StringTie BUSCO 3 mins
Viewing assembly in IGV IGV N/A

What you will learn in this Practical

Practicals for transcriptome assembly

There are three parts to the transcriptome assembly in this Prac. Please follow the instructions in order, because some commands will rely on the results from previous commands. Feel free to talk to tutors/instructors if you have a problem/question.

Part 1, Setup and data preparation

In this part, we will create some folders to keep files (including input RNA-Seq raw reads, databases and output files) organised.

1.1 Prepare folder structure for the project

For each project, I normally store files at different processing stages in different folders. I put initial input data into a data folder, and output files from different processing stages into separate folders in a results folder. If there are databases involved, I also create a DB folder. I store all scripts in a separate scripts folder (we won’t use this folder in this Prac).

mkdir prac_transcriptomics_assembly
cd prac_transcriptomics_assembly
mkdir 01_bin 02_DB 03_raw_data 04_results
cd 04_results
mkdir 01_QC 02_clean_data 03_genome_guided_assembly 04_denovo_assembly 05_final_assembly

The final folder structure for this project will look like this:

prac_transcriptomics_assembly/
├── 01_bin
├── 02_DB
├── 03_raw_data
└── 04_results
    ├── 01_QC
    ├── 02_clean_data
    ├── 03_genome_guided_assembly
    ├── 04_denovo_assembly
    └── 05_final_assembly

1.2 Raw data and DB

The initial RNA-Seq raw data is stored in the shared data directory ~/data/prac_assembly_week12.

Copy the raw data to your data folder

cp ~/data/prac_assembly_week12/*.fastq.gz ~/prac_transcriptomics_assembly/03_raw_data/

The databases, including Arabidopsis reference genome (TAIR10_chrALL.fa), annotated genes (TAIR10_GFF3_genes.gtf), and BUSCO lineages file (viridiplantae_odb10.2020-09-10.tar.gz) need to be copied to ~/data/prac_assembly_week12 and the tarball decompressed and untarred..

cp ~/data/prac_assembly_week12/TAIR10_* ~/prac_transcriptomics_assembly/02_DB/
cp ~/data/prac_assembly_week12/viridiplantae_odb10.2020-09-10.tar.gz ~/prac_transcriptomics_assembly/02_DB/
cd ~/prac_transcriptomics_assembly/02_DB
tar -zxvf viridiplantae_odb10.2020-09-10.tar.gz

Now, all the setup work is done. Let’s move to part 2.

Part 2, QC

In This part, we will use the skills that we learned from the NGS_practicals to do QC and trim adaptors and low-quality sequences from our RNA-Seq raw data.

2.1 QC for raw reads

The first step is to do QC for the raw reads using fastQC

cd ~/prac_transcriptomics_assembly/04_results/01_QC
fastqc -t 2 -o ./ ~/prac_transcriptomics_assembly/03_raw_data/*.fastq.gz

Then we can check the QC report of the raw reads.

2.2 Adaptor and low-quality sequence trimming

After we finish the QC for raw reads, we need to trim adaptor and low-quality sequences from the raw reads. The adapters for this RNA-Seq dataset are Illumina TrueSeq adapters as AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT.

cd ~/prac_transcriptomics_assembly/04_results/02_clean_data
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -o Col_leaf_chr2_R1.clean.fastq.gz -p Col_leaf_chr2_R2.clean.fastq.gz --minimum-length 25 --quality-cutoff 20 ~/prac_transcriptomics_assembly/03_raw_data/Col_leaf_chr2_R1.fastq.gz ~/prac_transcriptomics_assembly/03_raw_data/Col_leaf_chr2_R2.fastq.gz

Then we can do QC to check the clean reads.

2.3 QC for clean reads

cd ~/prac_transcriptomics_assembly/04_results/02_clean_data
fastqc -t 2 -o ./ *.clean.fastq.gz

We can check the QC reports for the clean reads and compare them with the raw reads.

Part 3, Genome guided transcriptome assembly (Only applicable if there is a reference genome)

In this section, we will do genome guided transcriptome assembly using STAR and StringTie.

3.1 Genome mapping using STAR

The first step for genome guided transcriptome assembly is to map RNA-Seq reads to a reference genome. We will use STAR to do this job in this practical (You can also choose other short RNA aligners to do the mapping).

For genome mapping using STAR, we first need to build the genome index.

cd ~/prac_transcriptomics_assembly/02_DB
STAR --runThreadN 2 --runMode genomeGenerate --genomeDir ~/prac_transcriptomics_assembly/02_DB/TAIR10_STAR125 --genomeFastaFiles TAIR10_chrALL.fa --sjdbGTFfile TAIR10_GFF3_genes.gtf --sjdbOverhang 124 --genomeSAindexNbases 12

And then, we map the clean reads to the reference genome. The command line for this is a little complicated, it is broken down below so that you can see what it is doing.

cd ~/prac_transcriptomics_assembly/04_results/03_genome_guided_assembly
STAR --genomeDir ~/prac_transcriptomics_assembly/02_DB/TAIR10_STAR125 --readFilesIn ~/prac_transcriptomics_assembly/04_results/02_clean_data/Col_leaf_chr2_R1.clean.fastq.gz \
~/prac_transcriptomics_assembly/04_results/02_clean_data/Col_leaf_chr2_R2.clean.fastq.gz --readFilesCommand zcat \
--runThreadN 2 --outSAMstrandField intronMotif --outSAMattributes All \
--outFilterMismatchNoverLmax 0.03 --alignIntronMax 10000 --outSAMtype BAM SortedByCoordinate \
--outFileNamePrefix Col_leaf_chr2. --quantMode GeneCounts

You can copy and paste this version.

cd ~/prac_transcriptomics_assembly/04_results/03_genome_guided_assembly
STAR --genomeDir ~/prac_transcriptomics_assembly/02_DB/TAIR10_STAR125 --readFilesIn ~/prac_transcriptomics_assembly/04_results/02_clean_data/Col_leaf_chr2_R1.clean.fastq.gz ~/prac_transcriptomics_assembly/04_results/02_clean_data/Col_leaf_chr2_R2.clean.fastq.gz --readFilesCommand zcat --runThreadN 2 --outSAMstrandField intronMotif --outSAMattributes All --outFilterMismatchNoverLmax 0.03 --alignIntronMax 10000 --outSAMtype BAM SortedByCoordinate --outFileNamePrefix Col_leaf_chr2. --quantMode GeneCounts

STAR will output multiple files with prefix Col_leaf_chr2. To get an idea about the mapping info, you can check Col_leaf_chr2.final.Log.out. The mapped reads are stored in a bam file called Col_leaf_chr2.Aligned.sortedByCoord.out.bam. To view this file in IGV, we need to create an index file.

cd ~/prac_transcriptomics_assembly/04_results/03_genome_guided_assembly
samtools index Col_leaf_chr2.Aligned.sortedByCoord.out.bam

In next step, we will use this mapped bam file to do genome guided transcriptome assembly.

3.2 Assembly using StringTie

The command for genome guided transcriptome assembly is as follows:

cd ~/prac_transcriptomics_assembly/04_results/03_genome_guided_assembly
stringtie Col_leaf_chr2.Aligned.sortedByCoord.out.bam -o StringTie.gtf -p 2

StringTie only outputs coordinates for assembled transcripts in into the assembled transcripts file. We can get the sequences of the assembled transcripts using a command called gffread.

cd ~/prac_transcriptomics_assembly/04_results/03_genome_guided_assembly
gffread -w StringTie.fasta -g ~/prac_transcriptomics_assembly/02_DB/TAIR10_chrALL.fa StringTie.gtf

3.3 Assessing the assembly quality using BUSCO

After we get the assembled transcripts, we need to find some ways to assess the quality of the assembly, such as the completeness of genes/transcripts. One way that we can check the assembly quality is by using BUSCO (Benchmarking Universal Single-Copy Orthologs, https://busco.ezlab.org/). BUSCO provides quantitative measures for the assessment of genome assembly, gene set, and transcriptome completeness, based on evolutionary-informed expectation of gene content from near-universal single-copy orthologs selected from different lineages.

BUSCO was installed under a different conda environment in VM, before run BUSCO, we need to activate the conda environment:

source activate busco

You should be able to see that your terminal prompt is now showing (busco) axxxxxxx@ip-xx-xxx-x-xx:/shared/axxxxxxx$ after the busco environment is activated.

cd ~/prac_transcriptomics_assembly/04_results/03_genome_guided_assembly
busco -i StringTie.fasta -l ~/prac_transcriptomics_assembly/02_DB/viridiplantae_odb10 -o BUSCO_StringTie_viridiplantae -m transcriptome --cpu 2

BUSCO will output a bunch of files including the information for predicted ORFs (Open Reading Frames) from assembled transcripts and output files from a blast search against orthologs. Of these output files, the most important one is the text file called short_summary_BUSCO_StringTie_viridiplantae.txt. In it you will find one summary line that looks like this C:20.2%[S:14.8%,D:5.4%],F:5.2%,M:74.6%,n:425. This line summarises the completeness of assembled transcripts, and explanations of these numbers can be found in the same text file after the one line summary.

        --------------------------------------------------
        |Results from dataset viridiplantae_odb10         |
        --------------------------------------------------
        |C:20.2%[S:14.8%,D:5.4%],F:5.2%,M:74.6%,n:425     |
        |86     Complete BUSCOs (C)                       |
        |63     Complete and single-copy BUSCOs (S)       |
        |23     Complete and duplicated BUSCOs (D)        |
        |22     Fragmented BUSCOs (F)                     |
        |317    Missing BUSCOs (M)                        |
        |425    Total BUSCO groups searched               |
        --------------------------------------------------

Part 4, De novo transcriptome assembly

In Part 2, we had trimmed the adapter and low-quality sequences from the reads. Next we will do de novo transcriptome assembly using Trinity.

Trinity is installed under a different conda environment named trinityenv, so we need to activate the environment before we run trinity:

source activate trinityenv

4.1 De novo assembly using Trinity

We will use the clean reads as input.

cd ~/prac_transcriptomics_assembly/04_results/04_denovo_assembly
Trinity --seqType fq --left ~/prac_transcriptomics_assembly/04_results/02_clean_data/Col_leaf_chr2_R1.clean.fastq.gz \
--right ~/prac_transcriptomics_assembly/04_results/02_clean_data/Col_leaf_chr2_R2.clean.fastq.gz \
--output Col_leaf_chr2_trinity --CPU 2 --max_memory 8G --bypass_java_version_check

This step will take more than 2 hours, so we will finish here today and let the VM finish the job, and we will come back to run the remaining analyses in next session.

4.2 Get Trinity assembly statistics

All results from Trinity will be stored in the folder of Col_leaf_chr2_trinity in the directory ~/prac_transcriptomics_assembly/04_results/04_denovo_assembly. It includes a lot of intermediate files and log files created during the Trinity assembly process. The final output file includes all final assembled transcripts and with suffix Trinity.fasta.

If you didn’t successfully complete the Trinity assembly. You can copy the final assembly output file from the shared data folder using following command:

cd ~/prac_transcriptomics_assembly/04_results/04_denovo_assembly
cp ~/data/prac_assembly_week12/Col_leaf_chr2_trinity.Trinity.fasta ./

The Trinity package provides a useful utility to summarise the basic assembly statistics.

cd ~/prac_transcriptomics_assembly/04_results/04_denovo_assembly
/usr/local/bin/util/TrinityStats.pl ./Col_leaf_chr2_trinity.Trinity.fasta

And you will get output like this:

################################
## Counts of transcripts, etc.
################################
Total trinity 'genes':  4495
Total trinity transcripts:      5473
Percent GC: 42.33

########################################
Stats based on ALL transcript contigs:
########################################

        Contig N10: 2975
        Contig N20: 2375
        Contig N30: 1928
        Contig N40: 1640
        Contig N50: 1410

        Median contig length: 731
        Average contig: 965.20
        Total assembled bases: 5282533


#####################################################
## Stats based on ONLY LONGEST ISOFORM per 'GENE':
#####################################################

        Contig N10: 2975
        Contig N20: 2299
        Contig N30: 1871
        Contig N40: 1580
        Contig N50: 1334

        Median contig length: 627
        Average contig: 895.56
        Total assembled bases: 4025531

This report gives us some basic statistics of the assembled transcripts from Trinity, such as the number of genes and transcripts and length of transcripts.

Questions: What is the difference between transcripts and genes? Why have we got more transcripts than genes?

4.3 Assessing the assembly quality using BUSCO

As we did before, we can use BUSCO to assess the assembly quality.

And remember to activate busco environment before you run busco.

cd ~/prac_transcriptomics_assembly/04_results/04_denovo_assembly
busco -i ./Col_leaf_chr2_trinity.Trinity.fasta -l ~/prac_transcriptomics_assembly/02_DB/viridiplantae_odb10 -o BUSCO_Trinity_viridiplantae -m transcriptome --cpu 2

Questions:

4.4 Align assembled transcripts to the genome (Only applicable if there is a reference genome)

Arabidopsis has a reference genome, therefore we can map the assembled transcripts to the reference genome to get a genomic coordinates file (GTF or GFF format). We will use an aligner called GMAP (http://research-pub.gene.com/gmap/) to do the genome mapping.

To use GMAP, we first need to build the genome index.

cd ~/prac_transcriptomics_assembly/02_DB
gmap_build -D ./ -d TAIR10_GMAP TAIR10_chrALL.fa

After building the genome index, we can map the assembled transcripts to the reference genome using following commands:

cd ~/prac_transcriptomics_assembly/04_results/04_denovo_assembly
gmap -D ~/prac_transcriptomics_assembly/02_DB/TAIR10_GMAP -d TAIR10_GMAP -t 2 -f 3 -n 1 ./Col_leaf_chr2_trinity.Trinity.fasta > Trinity.gff3

This will generate a GFF3 format file, including genomic coordinates for our de novo assembled transcripts, which we can import into IGV for visualisation.

Part 5, Visualising your assembled transcripts in IGV

After we finish the de novo transcriptome assembly and genome guided transcriptome assembly, we can visualise our results in IGV to check the assembly quality and look for interesting genes/transcripts.

First, we will put all the important final files into one folder.

cd ~/prac_transcriptomics_assembly/04_results/05_final_assembly
cp ~/prac_transcriptomics_assembly/04_results/03_genome_guided_assembly/StringTie.fasta ./
cp ~/prac_transcriptomics_assembly/04_results/03_genome_guided_assembly/StringTie.gtf ./
cp ~/prac_transcriptomics_assembly/04_results/03_genome_guided_assembly/Col_leaf_chr2.Aligned.sortedByCoord.out.bam ./
cp ~/prac_transcriptomics_assembly/04_results/03_genome_guided_assembly/Col_leaf_chr2.Aligned.sortedByCoord.out.bam.bai ./
cp ~/prac_transcriptomics_assembly/04_results/04_denovo_assembly/Col_leaf_chr2_trinity.Trinity.fasta ./
cp ~/prac_transcriptomics_assembly/04_results/04_denovo_assembly/Trinity.gff3 ./

Then we can check the assembled transcripts by loading the Trinity.gff3 and StringTie.gtf into IGV. We can also load the bam file into IGV to check the reads supporting assembled transcripts.

We will use online version of IGV in this Prac, and you can accsse the online IGV using this link.